Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 961556
End position: 961579
Length: 24

DNA sequence
>NC_015731, from 961556 to 961579 (24 bp); Nitrosomonas sp. Is79A3 AGATCCAGATCGGGATCCAGATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 961283-962797	Sequence	Nit79A3_0872 - 2-polyprenylphenol 6-hydroxylase (Protein is coded in complementary strand; from 962797 to 961283)