Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 2324017
End position: 2324041
Length: 25

DNA sequence
>NC_015731, from 2324017 to 2324041 (25 bp); Nitrosomonas sp. Is79A3 TGAATTGAACGGAATTAAATTAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2323820-2324920	Sequence	Nit79A3_2168 - Ribosomal RNA large subunit methyltransferase N (Protein is coded in complementary strand; from 2324920 to 2323820)