Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 2076512
End position: 2076538
Length: 27

DNA sequence
>NC_015731, from 2076512 to 2076538 (27 bp); Nitrosomonas sp. Is79A3 CCACCCATGCCACCCATGCCACCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2076500-2078152	Sequence	Nit79A3_1931 - molecular chaperone GroEL (Protein is coded in complementary strand; from 2078152 to 2076500)