Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 3480629
End position: 3480655
Length: 27

DNA sequence
>NC_015731, from 3480629 to 3480655 (27 bp); Nitrosomonas sp. Is79A3 GCCCGAATCGCCCGACTCGCCTGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3479055-3480791	Sequence	Nit79A3_3274 - ABC transporter (Protein is coded in complementary strand; from 3480791 to 3479055)