Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 820577
End position: 820603
Length: 27

DNA sequence
>NC_015731, from 820577 to 820603 (27 bp); Nitrosomonas sp. Is79A3 CCTGCCACCCCTGCCACCCCTGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 820066-822930	Sequence	Nit79A3_0748 - sulfatase-modifying factor protein (Protein is coded in complementary strand; from 822930 to 820066)