Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 1945702
End position: 1945736
Length: 35

DNA sequence
>NC_015731, from 1945702 to 1945736 (35 bp); Nitrosomonas sp. Is79A3 CTCTACTATACCCTAATCTACTCTAATCTACTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1945730-1946824	Sequence	Nit79A3_1812 - group 1 glycosyl transferase (Protein is coded in complementary strand; from 1946824 to 1945730)