Sequence retrieval

Genome: Nitrosomonas sp. Is79A3
Start position: 2462342
End position: 2462377
Length: 36

DNA sequence
>NC_015731, from 2462342 to 2462377 (36 bp); Nitrosomonas sp. Is79A3 AAGGTTCTGGTTCTGGTTCTGGTTCTGGTTCTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2462293-2462520	Sequence	Nit79A3_2301 - hypothetical protein (Protein is coded in complementary strand; from 2462520 to 2462293)