Sequence retrieval

Genome: Chlamydia trachomatis L2c
Start position: 652387
End position: 652410
Length: 24

DNA sequence
>NC_015744, from 652387 to 652410 (24 bp); Chlamydia trachomatis L2c TTTTTATTTCTTTATTTTTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 652407-655211	Sequence	CTL2C_547 - serine/threonine-protein kinase pknD (Protein is coded in complementary strand; from 655211 to 652407)