Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 114513
End position: 114536
Length: 24

DNA sequence
>NC_015875, from 114513 to 114536 (24 bp); Streptococcus pseudopneumoniae IS7493 AAAAAGAAAAGGAAAAATAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 114535-115557	Sequence	SPPN_00775 - phosphoribosylaminoimidazole synthetase