Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 1271865
End position: 1271888
Length: 24

DNA sequence
>NC_015875, from 1271865 to 1271888 (24 bp); Streptococcus pseudopneumoniae IS7493 CAGCAGCACCAGCTGCAGCAACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1271639-1272007	Sequence	SPPN_06670 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1272007 to 1271639)