Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 716377
End position: 716400
Length: 24

DNA sequence
>NC_015875, from 716377 to 716400 (24 bp); Streptococcus pseudopneumoniae IS7493 AAAGAGGAAGAGCAAGAGGAAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 715976-717316	Sequence	SPPN_03755 - sodium-dependent transporter (Protein is coded in complementary strand; from 717316 to 715976)