Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 944862
End position: 944885
Length: 24

DNA sequence
>NC_015875, from 944862 to 944885 (24 bp); Streptococcus pseudopneumoniae IS7493 ATATTGATATTGATGTTGAGATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 944082-945461	Sequence	SPPN_04980 glmU bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase