Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 1167705
End position: 1167731
Length: 27

DNA sequence
>NC_015875, from 1167705 to 1167731 (27 bp); Streptococcus pseudopneumoniae IS7493 ATTGTTTTCATTGTTTTCATTATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1166811-1167725	Sequence	SPPN_06135 - DNA-3-methyladenine glycosylase II (Protein is coded in complementary strand; from 1167725 to 1166811)
ORF. 1167694-1168494	Sequence	SPPN_06140 - hypothetical protein (Protein is coded in complementary strand; from 1168494 to 1167694)