Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 1591240
End position: 1591269
Length: 30

DNA sequence
>NC_015875, from 1591240 to 1591269 (30 bp); Streptococcus pseudopneumoniae IS7493 AACAATCGATCACCATCGATAGCAATCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1590928-1591380	Sequence	SPPN_08240 - beta-galactosidase subunit beta (Protein is coded in complementary strand; from 1591380 to 1590928)