Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 1145983
End position: 1146015
Length: 33

DNA sequence
>NC_015875, from 1145983 to 1146015 (33 bp); Streptococcus pseudopneumoniae IS7493 TTCTTTTTAGATTCTCTTTAGCTTCTTTTTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1145688-1146662	Sequence	SPPN_06015 - ribose transport operon repressor (Protein is coded in complementary strand; from 1146662 to 1145688)