Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 553436
End position: 553471
Length: 36

DNA sequence
>NC_015875, from 553436 to 553471 (36 bp); Streptococcus pseudopneumoniae IS7493 ATTTTCAACTAAATTTTTAAATAAATTTTCAACTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 552724-554067	Sequence	SPPN_03030 - ABC transporter ATP-binding protein