Sequence retrieval

Genome: Streptococcus pseudopneumoniae IS7493
Start position: 2056691
End position: 2056750
Length: 60

DNA sequence
>NC_015875, from 2056691 to 2056750 (60 bp); Streptococcus pseudopneumoniae IS7493 TACTACACTTTACTGCACTCTACTGCACTCTACTGCACTCTACTGCACTCTACTGCACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2056751-2058181	Sequence	SPPN_10870 - putative transcriptional regulator (Protein is coded in complementary strand; from 2058181 to 2056751)