Sequence retrieval

Genome: Kitasatospora setae KM-6054
Start position: 8754861
End position: 8754884
Length: 24

DNA sequence
>NC_016109, from 8754861 to 8754884 (24 bp); Kitasatospora setae KM-6054 GGCGCGGTCGCGGTCGCGGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8754802-8756955	Sequence	KSE_76590t - hypothetical protein (Protein is coded in complementary strand; from 8756955 to 8754802)