Sequence retrieval

Genome: Kitasatospora setae KM-6054
Start position: 2419002
End position: 2419028
Length: 27

DNA sequence
>NC_016109, from 2419002 to 2419028 (27 bp); Kitasatospora setae KM-6054 GAGGCGGCGGAGGCCGCGGAGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2418594-2419691	Sequence	KSE_21760 - putative peptidase C40 family protein (Protein is coded in complementary strand; from 2419691 to 2418594)