Sequence retrieval

Genome: Kitasatospora setae KM-6054
Start position: 2819829
End position: 2819861
Length: 33

DNA sequence
>NC_016109, from 2819829 to 2819861 (33 bp); Kitasatospora setae KM-6054 GGGCGCGGTCCGGGGGCGCTCCGGACGCGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2819860-2820738	Sequence	KSE_25320 - hypothetical protein (Protein is coded in complementary strand; from 2820738 to 2819860)