Sequence retrieval

Genome: Propionibacterium acnes TypeIA2 P.acn33
Start position: 1586788
End position: 1586811
Length: 24

DNA sequence
>NC_016516, from 1586788 to 1586811 (24 bp); Propionibacterium acnes TypeIA2 P.acn33 CGACCACGGCCACCACCACGTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1584775-1587669	Sequence	TIA2EST2_07395 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 1587669 to 1584775)