Sequence retrieval

Genome: Propionibacterium acnes TypeIA2 P.acn33
Start position: 1981265
End position: 1981300
Length: 36

DNA sequence
>NC_016516, from 1981265 to 1981300 (36 bp); Propionibacterium acnes TypeIA2 P.acn33 GTCGGAGTCGGCGTGGGAGTAGGAGTCGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1981088-1982014	Sequence	TIA2EST2_09145 - adhesion or S-layer protein (Protein is coded in complementary strand; from 1982014 to 1981088)