Sequence retrieval

Genome: Desulfosporosinus orientis DSM 765
Start position: 1971044
End position: 1971079
Length: 36

DNA sequence
>NC_016584, from 1971044 to 1971079 (36 bp); Desulfosporosinus orientis DSM 765 TTAGATTTCTTAGATTTCTTAGATTTCTTAGATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1970870-1973518	Sequence	Desor_1859 - CotS family spore coat protein (Protein is coded in complementary strand; from 1973518 to 1970870)