Sequence retrieval

Genome: Desulfosporosinus orientis DSM 765
Start position: 3001470
End position: 3001493
Length: 24

DNA sequence
>NC_016584, from 3001470 to 3001493 (24 bp); Desulfosporosinus orientis DSM 765 CTGTTCCTGTGCCTGATCCTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3000705-3001592	Sequence	Desor_2909 - ATPase component of various ABC-type transport systems with duplicated ATPase domain