Sequence retrieval

Genome: Desulfosporosinus orientis DSM 765
Start position: 3311726
End position: 3311749
Length: 24

DNA sequence
>NC_016584, from 3311726 to 3311749 (24 bp); Desulfosporosinus orientis DSM 765 TTGTCTTTTTCTTTGTCCTTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3310907-3311902	Sequence	Desor_3201 - stage V sporulation protein K (Protein is coded in complementary strand; from 3311902 to 3310907)