Sequence retrieval

Genome: Desulfosporosinus orientis DSM 765
Start position: 5063932
End position: 5063958
Length: 27

DNA sequence
>NC_016584, from 5063932 to 5063958 (27 bp); Desulfosporosinus orientis DSM 765 CGTACTATCCGTACTATCCGTACTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5063840-5064439	Sequence	Desor_4866 - flagellar hook capping protein (Protein is coded in complementary strand; from 5064439 to 5063840)