Sequence retrieval

Genome: Desulfosporosinus orientis DSM 765
Start position: 5417138
End position: 5417188
Length: 51

DNA sequence
>NC_016584, from 5417138 to 5417188 (51 bp); Desulfosporosinus orientis DSM 765 TTAATAACACCTTTGTCTTAATAACACCTTTGTCTTAATAACACCTTTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5417173-5417808	Sequence	Desor_5224 - AT-rich DNA-binding protein (Protein is coded in complementary strand; from 5417808 to 5417173)