Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 425295
End position: 425318
Length: 24

DNA sequence
>NC_016621, from 425295 to 425318 (24 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu TTTATATTCATATTTATTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 425046-425804	Sequence	BLBCPU_419 - hypothetical protein (Protein is coded in complementary strand; from 425804 to 425046)