Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 362337
End position: 362361
Length: 25

DNA sequence
>NC_016621, from 362337 to 362361 (25 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu TTTTATTTTTTTCTATTTCATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 362249-363670	Sequence	BLBCPU_359 hisS histidine-tRNA ligase (Protein is coded in complementary strand; from 363670 to 362249)