Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 538874
End position: 538898
Length: 25

DNA sequence
>NC_016621, from 538874 to 538898 (25 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu AAAATTAAATCAAATACAATAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 537569-539059	Sequence	BLBCPU_532 cysS cysteinyl-tRNA synthetase (Protein is coded in complementary strand; from 539059 to 537569)