Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 250338
End position: 250365
Length: 28

DNA sequence
>NC_016621, from 250338 to 250365 (28 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu TATATTTTCTATTTTATCTTTTATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 250058-250969	Sequence	BLBCPU_259 menA 1,4-dihydroxy-2-naphthoate octaprenyltransferase