Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 357193
End position: 357222
Length: 30

DNA sequence
>NC_016621, from 357193 to 357222 (30 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu AAAAAAAAGATAAAAAATAAAAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 357127-357444	Sequence	BLBCPU_352 - hypothetical protein (Protein is coded in complementary strand; from 357444 to 357127)