Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 450527
End position: 450556
Length: 30

DNA sequence
>NC_016621, from 450527 to 450556 (30 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu CATTTTTTTTCAAATTTTTTCGTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 448634-451210	Sequence	BLBCPU_443 uvrD ATP-dependent DNA helicase (Protein is coded in complementary strand; from 451210 to 448634)