Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 577927
End position: 577956
Length: 30

DNA sequence
>NC_016621, from 577927 to 577956 (30 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu CATTTATTATTAATTATTATTTTTTATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 577954-579027	Sequence	BLBCPU_563 mltD putative membrane-bound lytic murein transglycosylase (Protein is coded in complementary strand; from 579027 to 577954)