Sequence retrieval

Genome: Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu
Start position: 585705
End position: 585737
Length: 33

DNA sequence
>NC_016621, from 585705 to 585737 (33 bp); Blattabacterium sp. (Cryptocercus punctulatus) str. Cpu AATTTTTTAATAATTTTTTTTTAATTTCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 585095-589009	Sequence	BLBCPU_573 - hypothetical protein (Protein is coded in complementary strand; from 589009 to 585095)