Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1000916
End position: 1000939
Length: 24

DNA sequence
>NC_016622, from 1000916 to 1000939 (24 bp); Azospirillum lipoferum 4B GGGGGCGGCGGCGGGGGTGGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 999819-1000946	Sequence	AZOLI_1060 - putative cysteine synthase (Protein is coded in complementary strand; from 1000946 to 999819)