Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1035157
End position: 1035180
Length: 24

DNA sequence
>NC_016622, from 1035157 to 1035180 (24 bp); Azospirillum lipoferum 4B CGGTGGCGGCGGCGGTCGCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1034757-1035257	Sequence	AZOLI_1093 moaC molybdenum cofactor biosynthesis protein C (Protein is coded in complementary strand; from 1035257 to 1034757)