Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1119431
End position: 1119457
Length: 27

DNA sequence
>NC_016622, from 1119431 to 1119457 (27 bp); Azospirillum lipoferum 4B CCCGGCCAGCCCGCCCAGCCCGGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1119252-1121258	Sequence	AZOLI_1176 - ABC transporter, ATP-binding and permease domains (Protein is coded in complementary strand; from 1121258 to 1119252)