Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1177653
End position: 1177688
Length: 36

DNA sequence
>NC_016622, from 1177653 to 1177688 (36 bp); Azospirillum lipoferum 4B TCACCGCCGGTCTCAACGCCAGTCTCAACGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1177593-1180418	Sequence	AZOLI_1235 gyrA DNA gyrase subunit A (Protein is coded in complementary strand; from 1180418 to 1177593)