Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1406501
End position: 1406545
Length: 45

DNA sequence
>NC_016622, from 1406501 to 1406545 (45 bp); Azospirillum lipoferum 4B GCCCTTGTCGACGCCGACCTTGGCGACGCGGACCTTGTCCACGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1406310-1406720	Sequence	AZOLI_1484 flgC1 flagellar basal-body rod protein FlgC (Protein is coded in complementary strand; from 1406720 to 1406310)