Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1546228
End position: 1546251
Length: 24

DNA sequence
>NC_016622, from 1546228 to 1546251 (24 bp); Azospirillum lipoferum 4B CGGTCACGGTCACGGTCACGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1546093-1547685	Sequence	AZOLI_1627 rhlE2 ATP-dependent RNA helicase (Protein is coded in complementary strand; from 1547685 to 1546093)