Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1711832
End position: 1711864
Length: 33

DNA sequence
>NC_016622, from 1711832 to 1711864 (33 bp); Azospirillum lipoferum 4B GGGCGGCGGGGCGGCGGCGGTGGGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1711739-1712158	Sequence	AZOLI_1823 - putative Class I peptide chain release factor (Protein is coded in complementary strand; from 1712158 to 1711739)