Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1713015
End position: 1713038
Length: 24

DNA sequence
>NC_016622, from 1713015 to 1713038 (24 bp); Azospirillum lipoferum 4B GGCGGCGGCGGGAGCGGCGGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1712155-1713057	Sequence	AZOLI_1824 ksgA Dimethyladenosine transferase (Protein is coded in complementary strand; from 1713057 to 1712155)