Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 1930602
End position: 1930625
Length: 24

DNA sequence
>NC_016622, from 1930602 to 1930625 (24 bp); Azospirillum lipoferum 4B CACCGCCGCCGCCAGCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1930015-1930605	Sequence	AZOLI_2051 - hypothetical protein (Protein is coded in complementary strand; from 1930605 to 1930015)