Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 204256
End position: 204282
Length: 27

DNA sequence
>NC_016622, from 204256 to 204282 (27 bp); Azospirillum lipoferum 4B GGTGACGCTGGTGAAGCTGGTGACGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 203170-204324	Sequence	AZOLI_0209 - hypothetical protein (Protein is coded in complementary strand; from 204324 to 203170)