Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2079958
End position: 2080002
Length: 45

DNA sequence
>NC_016622, from 2079958 to 2080002 (45 bp); Azospirillum lipoferum 4B GTCGTCGTGGCCATGATCGTCGTGGGAATGGTCGTCATGGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2078057-2080153	Sequence	AZOLI_2195 nuoL NADH-quinone oxidoreductase subunit L (Protein is coded in complementary strand; from 2080153 to 2078057)