Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 211426
End position: 211452
Length: 27

DNA sequence
>NC_016622, from 211426 to 211452 (27 bp); Azospirillum lipoferum 4B CGCCGGCTGCGCCGTCTGCGCCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 208901-211624	Sequence	AZOLI_0216 - diguanylate cyclase/phosphodiesterase with PAS/PAC domain (Protein is coded in complementary strand; from 211624 to 208901)