Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2281088
End position: 2281111
Length: 24

DNA sequence
>NC_016622, from 2281088 to 2281111 (24 bp); Azospirillum lipoferum 4B GCTGTCGCTGCCGCTGACGCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2279332-2281626	Sequence	AZOLI_2426 cheA1 Chemotaxis sensor histidine kinase CheA