Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2368024
End position: 2368047
Length: 24

DNA sequence
>NC_016622, from 2368024 to 2368047 (24 bp); Azospirillum lipoferum 4B GGCCGCGGGCGCGGCTGCGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2366691-2369468	Sequence	AZOLI_2508 - putative ATP-dependent DNA helicase (Protein is coded in complementary strand; from 2369468 to 2366691)