Sequence retrieval

Genome: Azospirillum lipoferum 4B
Start position: 2379599
End position: 2379622
Length: 24

DNA sequence
>NC_016622, from 2379599 to 2379622 (24 bp); Azospirillum lipoferum 4B CGCCTGCGCCTGCTCCTGCGCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2375883-2379776	Sequence	AZOLI_2515 - Hybrid sensor histidine kinase (Protein is coded in complementary strand; from 2379776 to 2375883)